Scribble Death

Free download. Book file PDF easily for everyone and every device. You can download and read online Scribble Death file PDF Book only if you are registered here. And also you can download or read online all Book PDF file that related with Scribble Death book. Happy reading Scribble Death Bookeveryone. Download file Free Book PDF Scribble Death at Complete PDF Library. This Book have some digital formats such us :paperbook, ebook, kindle, epub, fb2 and another formats. Here is The CompletePDF Book Library. It's free to register here to get Book file PDF Scribble Death Pocket Guide.

In recently published work Scribble heterozygosity causes prostate hyperplasia, while prostate-specific knockout of Scribble results in loss of cellular polarity, elevated proliferation and progression to intraepithelial neoplasia [23]. These data underline the fundamental role of Scribble for the establishment and maintenance of epithelial cell polarity, cell migration and tissue architecture. Here we analysed the spatiotemporal expression of Scribble during glomerular development and generated podocyte-specific and constitutive Scribble knockout mice to investigate the role of Scribble in podocyte differentiation and maintenance.

Role of the Polarity Protein Scribble for Podocyte Differentiation and Maintenance

Previously, we identified that the aPKC complex translocates from the apical to basal membranes during podocyte differentiation, preceding the development of primary and foot processes [5]. To study the protein localisation of Scribble during glomerular development, we co-stained the apical membrane marker Podocalyxin and Par3 with Scribble in newborn rat kidney sections. Whereas Par3 is already expressed during comma-shaped body stage and localizes to the apical sited cell-cell contacts, expression of Podocalyxin starts during s-shaped body stage, when Par3 and the cell-cell contacts migrate along the lateral side of immature podocytes Figure 1 A.

Interestingly, Scribble appears to be enriched basally of Par3 during the comma-shaped body stage and translocates like Par3 during podocyte differentiation to the developing foot processes Figure 1 B, Figure S1. While Podocalyxin and Par3 as well as Par3 and Scribble display a partial overlap of their localization, no overlap of Podocalyxin and Scribble can be detected indicating localization to completely distinct membrane areas with Podocalyxin being an apical membrane marker and Scribble being a basolateral marker protein Figure 1 C.

To reveal the subcellular localisation of Scribble in podocytes we performed immunogold stainings of newborn and adult rat kidney sections. In immature podocytes Scribble localizes at the cell-cell contacts Figure 2 A , while in differentiated podocytes it can be detected predominantly at the basolateral side of the foot processes basal of the slit diaphragm and also partially at the slit-diaphragm Figure 2 B. Figure 3 schematically illustrates the localization of Podocalyxin, Par3 and Scribble during podocyte differentiation.

Frozen kidney sections of newborn Wistar rat P0 were stained using antibodies against the apical membrane protein Podocalyxin, the apical polarity protein Par3 and the basolateral polarity protein Scribble and were subjected to confocal laser microscopy. Since glomerular development is asynchronous, kidneys of newborn rats display various glomerular developmental stages. Each panel displays the expression pattern of the accordant proteins during glomerular development from left to right : Developmental stages ranging from comma-shaped body I , s-shaped body II , capillary loop stage III to IV , to a maturing glomerulus V.

A Whereas Par3 is expressed during comma-shaped body stage and localizes to the apical sited cell-cell junctions, expression of Podocalyxin starts during s-shaped body stage, when Par3 and the cell-cell contacts translocate along the lateral side of immature podocytes to basal.


  1. Scribble Death by Franz Kamin (2010, Paperback);
  2. Unfinished Synthesis: Biological Hierarchies and Modern Evolutionary Thought.
  3. Heat and Mass Transfer in Porous Media.
  4. Bomb the Suburbs: Graffiti, Race, Freight-Hopping and the Search for Hip-Hop’s Moral Center.
  5. Daytrading University - Advanced Daytrading Two-Day Seminar?

During this translocation the apical membrane area, marked by Podocalyxin, increases while the basolateral membrane area shrinks relatively. Arrows indicate translocation of Par3 from the apical cell-cell contacts in I to the developing foot processes in V. B Scribble localizes basal of Par3 at the cell-cell junctions and at the basolateral membrane during comma-shaped body stage I and translocates like Par3 during podocyte differentation to the developing foot processes in V.

Scribble Tom

C While Podocalyxin and Par3 as well as Par3 and Scribble display an partial overlap of their localization yellow in A and B , no overlap of Podocalyxin and Scribble can be detected indicating a localization to completely distinct membrane areas with Podocalyxin as an apical membrane marker and Scribble as a basolateral marker protein. A Immunogold electron microscopy of P0 rat kidney sections displays localization of Scribble arrows at immature podocyte cell-cell contacts.

2 Responses to “Standing Death”

B In adult rat kidney sections Scribble localizes predominantly at the basolateral side of podocyte foot processes and partially at the slit-diaphragm. Scale bars: nm. During podocyte differentiation the cell-cell contacts translocate from the apical site along the lateral membrane to basal, where primary processes and foot processes develop.

Par3 localizes to the cell-cell contacts, moves with them to basal and localizes to the cell-cell contact of mature podocytes, the slit diaphragm, which bridges the filtration slit between foot processes.

Profile Menu

Scribble localizes basal of Par3 at the cell-cell junctions and the basolateral membrane of immature podocytes. In mature podocytes Scribble localizes to the basolateral membrane, which is defined as the area beneath the slit-diaphragm. Differentiation of podocytes is accompanied with an enlargement of the apical membrane area, marked by Podocalyxin, whose expression starts parallel with the translocation of the cell-cell contacts to basal in s-shaped body stage. Relative to this apical membrane enlargement the basolateral membrane, marked by Scribble, shrinks to the area beneath the slit-diaphragm in mature podocytes.

While Scribble can still be detected in other glomerular cells, co-staining with the podocyte marker protein Nephrin confirmed complete loss of Scribble in podocytes in confocal microscopy Figure 4 C, D. A Generation of tissue-specific Scribble knockout mice. Arrows indicate the podocyte foot process compartment.

C, D Transmission electron micrographs display normal podocyte architecture with foot processes without any obvious ultrastructural defect. Cre mice. To study the effect of Scribble knockout on early glomerular development and podocyte differentiation, we analyzed kidneys of constitutive Scribble knockout mice. Most constitutive Scribble knockout animals die during embryonic development between E To monitor the glomerular development we harvested the kidneys at E Figure 6 B illustrates the development of Scribble wildtype and knockout kidneys in culture for 6 days.

Immunofluorescence staining against WT1 and Scribble confirmed complete loss of Scribble in Scribble knockout kidney culture Figure 6 C , while expression of the podocyte marker proteins Podocin and Nephrin as well as the polarity protein Par3 could be detected in glomeruli of Scribble knockout kidney cultures Figure 6 D. Ultrastructural analysis disclosed podocyte foot processes connected by slit diaphragms in Scribble knockout and wildtype kidney culture glomeruli Figure 6 E.

We next analysed homozygous circletail mutant mice, which express a shortened Scribble protein lacking the third and fourth c-terminal PDZ domains leading to craniorachischisis, gastroschisis and late embryonic death around E18 [12]. No obvious morphological alteration of podocyte foot processes could be detected in these mice Figure 6 F , indicating that Scribble is dispensable for regular foot process development.

B Kidneys of Scribble knockout and wildtype littermate embryos were harvested at P C Immunofluorescence staining against WT1, which is expressed in podocytes and embryonic kidney epithelial cells, and Scribble reveals complete loss of Scribble in Scribble knockout kidney culture arrows indicate glomeruli , D while expression of the podocyte marker proteins Podocin and Nephrin as well as the apical polarity protein Par3 can be detected in Scribble knockout kidney culture glomeruli. E Electron micrographs show development of podocyte foot processes connected by slit diaphragms in Scribble knockout and wildtype kidney culture glomeruli P, podocyte; GBM, glomerular basement membrane.

Arrow heads indicate localization of foot processes, arrows indicate slit diaphragms. F Circletail mutant mice, bearing a mutation in the Scribble gene, which results in a shortened protein lacking third and fourth c-terminal PDZ domains, die during late embryonic development. Transmission electron micrographs display podocytes with normal foot process architecture and slit-diaphragms and without any obvious abnormalities. In epithelial cells Par3 is located at the tight junctions marking the border between apical and basolateral membrane compartments [3].

Previously we demonstrated that Par3 co-localizes with the tight junction protein ZO-1 at the apical cell-cell contacts of immature podocytes as well as at the slit diaphragm of mature podocytes [2] , [5]. Here we could demonstrate that another polarity protein, Scribble, is enriched in podocytes. During differentiation the immature cell-cell contacts and Par3 as well as Scribble translocate towards the basal aspects of the podocyte, followed by primary and foot process development Figure 1.

Interestingly, Scribble appears to localize basally of Par3 during podocyte differentiation as well as in mature podocytes.

A Scribble of Death Robots

In agreement, in polarized MDCK cells it has been described that Scribble localizes basal of the tight junctions at the adherens junctions [9]. Strikingly, mature podocytes do not feature classical tight or adherens junctions but a unique cell-cell contact, the slit diaphragm, which bridges foot processes of neighbouring podocytes.


  1. Commits · TestServer · Scribble / GDLEnhanced2 · GitLab;
  2. Blast Wave Diagnostic for the Petawatt Laser System?
  3. Remote Pairing: Collaborative Tools for Distributed Development.
  4. Jews and India: Perceptions and Image (Routledge Jewish Studies Series);
  5. FTCE Middle Grades Math 5-9 (XAM FTCE).
  6. Biology Dictionary.

The slit diaphragm displays characteristics of both, tight junctions with associated proteins such as ZO-1 [26] , Jam4 [27] and Par3 [2] as well as adherens junctions with proteins like P-cadherin [28]. This unique cell-cell contact makes it difficult to predict the function of single junctional components. In MDCK epithelial cells knockdown of Scribble causes delayed tight junction assembly and disrupts cell adhesion [10].

However, it remained completely unclear whether Scribble also significantly contributes to the development and maintenance of podocyte slit diaphragms. Therefore, we generated podocyte-specific Scribble knockout mice. Unexpectedly, no morphological or clinical abnormalities could be detected in these mice Figure 4 and 5. Since the NPHS2 -promoter activates Cre expression relatively late during glomerular development [24] , [25] , a developmental phenotype of podocyte-specific deletion of Scribble might be masked.

For this reason we analyzed constitutive Scribble knockout mice and circletail mice, in which Scribble is truncated after the second PDZ domain, which results in late embryonic death [12]. Constitutive Scribble knockout mice die intraembryonally between E To study glomerular development we performed kidney culture experiments. Podocytes in constitutive Scribble knockout kidney culture as well as podocytes of circletail mice develop foot processes being connected by the slit diaphragm showing no morphological abnormalities compared to control podocytes indicating that Scribble is dispensable for podocyte foot process development Figure 6.

voltninisefee.gq However, if other basal polarity proteins are involved in podocyte shape formation, has to be addressed in future studies. In summary, while Scribble seems to be important for general epithelial cell- [9] and pronephros [29] development, it appears to be dispensable for podocyte function and development. This unexpected result underlines the unique features of polarity programs shaping the complex three-dimensional podocyte architecture.

Striking characteristics of developing podocytes are the expansion of apical membranes going along with a shrinking of basal membrane compartments as illustrated in Figure 1 and 3. This appears to be congruent with the observation that podocyte differentiation is rather being driven by apical polarity complex signaling while Scribble signaling is not required for the specialized podocyte architecture.

Cre-mediated recombination causes a frame shift and early stop of translation. Mice carrying the circletail allele of Scribble were purchased from The Jackson Laboratory. For genotyping or detection of deletion of Scribble exons 2—8 DNA was isolated from tail clip or isolated glomeruli, respectively. For detection of WT or the loxP site, the primers were tccagttagcactcaggcgtcagg forward and cagctccgagaggttctcacagtcc reverse.

For detection of the deletion, primers were accccagtgctctctggtgtttttattg forward and cagctccgagaggttctcacagtcc reverse. For detecting the circletail mutation, primers were ctagccctcccccccc forward; locked nucleic acid primer and cctgggactgagaaggacat reverse.